The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Mô tả đầy đủ

Chi tiết về thư mục

Xuất bản năm:	Nucleic Acids Res
Những tác giả chính:	Takaiwa, F, Kusuda, M, Sugiura, M
Định dạng:	Artigo
Ngôn ngữ:	Inglês
Được phát hành:	Oxford University Press 1982
Những chủ đề:	Research Article
Truy cập trực tuyến:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257
Các nhãn:	Thêm thẻ Không có thẻ, Là người đầu tiên thẻ bản ghi này!