Đang tải...

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Mô tả đầy đủ

Đã lưu trong:
Chi tiết về thư mục
Những tác giả chính: Takaiwa, F, Kusuda, M, Sugiura, M
Định dạng: Artigo
Ngôn ngữ:Inglês
Được phát hành: 1982
Những chủ đề:
Truy cập trực tuyến:https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/
https://ncbi.nlm.nih.gov/pubmed/7201130
Các nhãn: Thêm thẻ
Không có thẻ, Là người đầu tiên thẻ bản ghi này!