Đang tải...
The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...
Đã lưu trong:
| Những tác giả chính: | , , |
|---|---|
| Định dạng: | Artigo |
| Ngôn ngữ: | Inglês |
| Được phát hành: |
1982
|
| Những chủ đề: | |
| Truy cập trực tuyến: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/ https://ncbi.nlm.nih.gov/pubmed/7201130 |
| Các nhãn: |
Thêm thẻ
Không có thẻ, Là người đầu tiên thẻ bản ghi này!
|