The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-...

ver descrição completa

Detalhes bibliográficos

Publicado no:	Nucleic Acids Res
Principais autores:	Takaiwa, F, Sugiura, M
Formato:	Artigo
Idioma:	Inglês
Publicado em:	Oxford University Press 1982
Acesso em linha:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320878/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6815619/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.17.5369
Tags:	Adicionar Tag Sem tags, seja o primeiro a adicionar uma tag!