Loading...

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Main Authors: Takaiwa, F, Sugiura, M
Format: Artigo
Sprog:Inglês
Udgivet: 1982
Online adgang:https://ncbi.nlm.nih.gov/pmc/articles/PMC320878/
https://ncbi.nlm.nih.gov/pubmed/6815619
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!