Carregant...

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-...

Descripció completa

Guardat en:
Dades bibliogràfiques
Autors principals: Takaiwa, F, Sugiura, M
Format: Artigo
Idioma:Inglês
Publicat: 1982
Accés en línia:https://ncbi.nlm.nih.gov/pmc/articles/PMC320878/
https://ncbi.nlm.nih.gov/pubmed/6815619
Etiquetes: Afegir etiqueta
Sense etiquetes, Sigues el primer a etiquetar aquest registre!