A carregar...
The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.
Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-...
Na minha lista:
| Main Authors: | , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1982
|
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320878/ https://ncbi.nlm.nih.gov/pubmed/6815619 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|