טוען...

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-...

תיאור מלא

שמור ב:
מידע ביבליוגרפי
Main Authors: Takaiwa, F, Sugiura, M
פורמט: Artigo
שפה:Inglês
יצא לאור: 1982
גישה מקוונת:https://ncbi.nlm.nih.gov/pmc/articles/PMC320878/
https://ncbi.nlm.nih.gov/pubmed/6815619
תגים: הוספת תג
אין תגיות, היה/י הראשונ/ה לתייג את הרשומה!