The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.
Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-...
שמור ב:
| הוצא לאור ב: | Nucleic Acids Res |
|---|---|
| Principais autores: | , |
| פורמט: | Artigo |
| שפה: | Inglês |
| יצא לאור: |
Oxford University Press
1982
|
| גישה מקוונת: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320878/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6815619/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.17.5369 |
| תגים: |
אין תגיות, היה/י הראשונ/ה לתייג את הרשומה!
|