A carregar...
The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
Na minha lista:
| Main Authors: | , , , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1982
|
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320948/ https://ncbi.nlm.nih.gov/pubmed/7145715 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|