Carregant...

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Guardat en:
Dades bibliogràfiques
Autors principals: Takaiwa, F, Kusuda, M, Saga, N, Sugiura, M
Format: Artigo
Idioma:Inglês
Publicat: 1982
Accés en línia:https://ncbi.nlm.nih.gov/pmc/articles/PMC320948/
https://ncbi.nlm.nih.gov/pubmed/7145715
Etiquetes: Afegir etiqueta
Sense etiquetes, Sigues el primer a etiquetar aquest registre!