The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Bibliografiske detaljer

Udgivet i:	Nucleic Acids Res
Principais autores:	Takaiwa, F, Kusuda, M, Saga, N, Sugiura, M
Format:	Artigo
Sprog:	Inglês
Udgivet:	Oxford University Press 1982
Online adgang:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320948/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7145715/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.19.6037
Tags:	Tilføj Tag Ingen Tags, Vær først til at tagge denne postø!