A carregar...

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Na minha lista:
Detalhes bibliográficos
Main Authors: Takaiwa, F, Kusuda, M, Saga, N, Sugiura, M
Formato: Artigo
Idioma:Inglês
Publicado em: 1982
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC320948/
https://ncbi.nlm.nih.gov/pubmed/7145715
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!