The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Gorde:
Xehetasun bibliografikoak
Argitaratua izan da:Nucleic Acids Res
Egile Nagusiak: Takaiwa, F, Kusuda, M, Saga, N, Sugiura, M
Formatua: Artigo
Hizkuntza:Inglês
Argitaratua: Oxford University Press 1982
Sarrera elektronikoa:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320948/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7145715/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.19.6037
Etiketak: Etiketa erantsi
Etiketarik gabe, Izan zaitez lehena erregistro honi etiketa jartzen!

Antzeko izenburuak