Wird geladen...

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Gespeichert in:
Bibliographische Detailangaben
Hauptverfasser: Takaiwa, F, Kusuda, M, Saga, N, Sugiura, M
Format: Artigo
Sprache:Inglês
Veröffentlicht: 1982
Online Zugang:https://ncbi.nlm.nih.gov/pmc/articles/PMC320948/
https://ncbi.nlm.nih.gov/pubmed/7145715
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!