Wird geladen...
The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
Gespeichert in:
| Hauptverfasser: | , , , |
|---|---|
| Format: | Artigo |
| Sprache: | Inglês |
| Veröffentlicht: |
1982
|
| Online Zugang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320948/ https://ncbi.nlm.nih.gov/pubmed/7145715 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|