Loading...
The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
Saved in:
| Published in: | Nucleic Acids Res |
|---|---|
| Main Authors: | , , , |
| Format: | Artigo |
| Language: | Inglês |
| Published: |
Oxford University Press
1982
|
| Online Access: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320948/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7145715/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.19.6037 |
| Tags: |
Add Tag
No Tags, Be the first to tag this record!
|