Ładuje się......
The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
Zapisane w:
| Główni autorzy: | , , , |
|---|---|
| Format: | Artigo |
| Język: | Inglês |
| Wydane: |
1982
|
| Dostęp online: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320948/ https://ncbi.nlm.nih.gov/pubmed/7145715 |
| Etykiety: |
Dodaj etykietę
Nie ma etykietki, Dołącz pierwszą etykiete!
|