The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Saved in:
Bibliographic Details
Published in:Nucleic Acids Res
Main Authors: Takaiwa, F, Kusuda, M, Saga, N, Sugiura, M
Format: Artigo
Language:Inglês
Published: Oxford University Press 1982
Online Access:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320948/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7145715/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.19.6037
Tags: Add Tag
No Tags, Be the first to tag this record!

Similar Items