Ładuje się......
The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...
Zapisane w:
| Główni autorzy: | , , |
|---|---|
| Format: | Artigo |
| Język: | Inglês |
| Wydane: |
1982
|
| Hasła przedmiotowe: | |
| Dostęp online: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/ https://ncbi.nlm.nih.gov/pubmed/7201130 |
| Etykiety: |
Dodaj etykietę
Nie ma etykietki, Dołącz pierwszą etykiete!
|