A carregar...

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Main Authors: Takaiwa, F, Kusuda, M, Sugiura, M
Formato: Artigo
Idioma:Inglês
Publicado em: 1982
Assuntos:
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/
https://ncbi.nlm.nih.gov/pubmed/7201130
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!