Lataa...
The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...
Tallennettuna:
| Julkaisussa: | Nucleic Acids Res |
|---|---|
| Päätekijät: | , , |
| Aineistotyyppi: | Artigo |
| Kieli: | Inglês |
| Julkaistu: |
Oxford University Press
1982
|
| Aiheet: | |
| Linkit: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257 |
| Tagit: |
Lisää tagi
Ei tageja, Lisää ensimmäinen tagi!
|