The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Whakaahuatanga katoa

Ngā taipitopito rārangi puna kōrero

I whakaputaina i:	Nucleic Acids Res
Ngā kaituhi matua:	Takaiwa, F, Kusuda, M, Sugiura, M
Hōputu:	Artigo
Reo:	Inglês
I whakaputaina:	Oxford University Press 1982
Ngā marau:	Research Article
Urunga tuihono:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257
Ngā Tūtohu:	Tāpirihia he Tūtohu Kāore He Tūtohu, Me noho koe te mea tuatahi ki te tūtohu i tēnei pūkete!