The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...
Kaydedildi:
| Yayımlandı: | Nucleic Acids Res |
|---|---|
| Asıl Yazarlar: | , , |
| Materyal Türü: | Artigo |
| Dil: | Inglês |
| Baskı/Yayın Bilgisi: |
Oxford University Press
1982
|
| Konular: | |
| Online Erişim: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257 |
| Etiketler: |
Etiket eklenmemiş, İlk siz ekleyin!
|