The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...
में बचाया:
| में प्रकाशित: | Nucleic Acids Res |
|---|---|
| मुख्य लेखकों: | , , |
| स्वरूप: | Artigo |
| भाषा: | Inglês |
| प्रकाशित: |
Oxford University Press
1982
|
| विषय: | |
| ऑनलाइन पहुंच: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257 |
| टैग: |
कोई टैग नहीं, इस रिकॉर्ड को टैग करने वाले पहले व्यक्ति बनें!
|