The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Disgrifiad llawn

Manylion Llyfryddiaeth

Cyhoeddwyd yn:	Nucleic Acids Res
Prif Awduron:	Takaiwa, F, Kusuda, M, Sugiura, M
Fformat:	Artigo
Iaith:	Inglês
Cyhoeddwyd:	Oxford University Press 1982
Pynciau:	Research Article
Mynediad Ar-lein:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257
Tagiau:	Ychwanegu Tag Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!