The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...
Sábháilte in:
| Foilsithe in: | Nucleic Acids Res |
|---|---|
| Príomhchruthaitheoirí: | , , |
| Formáid: | Artigo |
| Teanga: | Inglês |
| Foilsithe / Cruthaithe: |
Oxford University Press
1982
|
| Ábhair: | |
| Rochtain ar líne: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257 |
| Clibeanna: |
Níl clibeanna ann, Bí ar an gcéad duine le clib a chur leis an taifead seo!
|