Wordt geladen...

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Volledige beschrijving

Bewaard in:
Bibliografische gegevens
Hoofdauteurs: Takaiwa, F, Kusuda, M, Sugiura, M
Formaat: Artigo
Taal:Inglês
Gepubliceerd in: 1982
Onderwerpen:
Online toegang:https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/
https://ncbi.nlm.nih.gov/pubmed/7201130
Tags: Voeg label toe
Geen labels, Wees de eerste die dit record labelt!