Wordt geladen...
The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...
Bewaard in:
| Hoofdauteurs: | , , |
|---|---|
| Formaat: | Artigo |
| Taal: | Inglês |
| Gepubliceerd in: |
1982
|
| Onderwerpen: | |
| Online toegang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/ https://ncbi.nlm.nih.gov/pubmed/7201130 |
| Tags: |
Voeg label toe
Geen labels, Wees de eerste die dit record labelt!
|