Wird geladen...

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Hauptverfasser: Takaiwa, F, Kusuda, M, Sugiura, M
Format: Artigo
Sprache:Inglês
Veröffentlicht: 1982
Schlagworte:
Online Zugang:https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/
https://ncbi.nlm.nih.gov/pubmed/7201130
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!