Cargando...

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Descrición completa

Gardado en:
Detalles Bibliográficos
Main Authors: Takaiwa, F, Kusuda, M, Sugiura, M
Formato: Artigo
Idioma:Inglês
Publicado: 1982
Assuntos:
Acceso en liña:https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/
https://ncbi.nlm.nih.gov/pubmed/7201130
Tags: Engadir etiqueta
Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!