Loading...

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Main Authors: Takaiwa, F, Kusuda, M, Sugiura, M
Format: Artigo
Sprog:Inglês
Udgivet: 1982
Fag:
Online adgang:https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/
https://ncbi.nlm.nih.gov/pubmed/7201130
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!