Export Ready — 

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Full description

Saved in:
Bibliographic Details
Main Authors: Takaiwa, F, Kusuda, M, Sugiura, M
Format: Artigo
Language:Inglês
Published: 1982
Subjects:
Research Article
Online Access:https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/
https://ncbi.nlm.nih.gov/pubmed/7201130
Tags: Add Tag
No Tags, Be the first to tag this record!

Similar Items