The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Ausführliche Beschreibung

Bibliografische Detailangaben

Veröffentlicht in:	Nucleic Acids Res
Hauptverfasser:	Takaiwa, F, Kusuda, M, Sugiura, M
Format:	Artigo
Sprache:	Inglês
Veröffentlicht:	Oxford University Press 1982
Schlagworte:	Research Article
Online-Zugang:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257
Tags:	Tag hinzufügen Keine Tags, Fügen Sie das erste Tag hinzu!