The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...

Description complète

Détails bibliographiques

Publié dans:	Nucleic Acids Res
Auteurs principaux:	Takaiwa, F, Kusuda, M, Sugiura, M
Format:	Artigo
Langue:	Inglês
Publié:	Oxford University Press 1982
Sujets:	Research Article
Accès en ligne:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320607/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7201130/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.7.2257
Tags:	Ajouter un tag Pas de tags, Soyez le premier à ajouter un tag!