A carregar...
The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.
Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...
Na minha lista:
| Main Authors: | , , , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1981
|
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC326894/ https://ncbi.nlm.nih.gov/pubmed/7279661 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|