Načítá se...

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...

Celý popis

Uloženo v:
Podrobná bibliografie
Vydáno v:Nucleic Acids Res
Hlavní autoři: Delihas, N, Andersen, J, Sprouse, H M, Dudock, B
Médium: Artigo
Jazyk:Inglês
Vydáno: Oxford University Press 1981
On-line přístup:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326894/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7279661/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.12.2801
Tagy: Přidat tag
Žádné tagy, Buďte první, kdo otaguje tento záznam!