Wird geladen...

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Hauptverfasser: Delihas, N, Andersen, J, Sprouse, H M, Dudock, B
Format: Artigo
Sprache:Inglês
Veröffentlicht: 1981
Online Zugang:https://ncbi.nlm.nih.gov/pmc/articles/PMC326894/
https://ncbi.nlm.nih.gov/pubmed/7279661
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!