Načítá se...
The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.
Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...
Uloženo v:
| Vydáno v: | Nucleic Acids Res |
|---|---|
| Hlavní autoři: | , , , |
| Médium: | Artigo |
| Jazyk: | Inglês |
| Vydáno: |
Oxford University Press
1981
|
| On-line přístup: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326894/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7279661/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.12.2801 |
| Tagy: |
Přidat tag
Žádné tagy, Buďte první, kdo otaguje tento záznam!
|