Wird geladen...
The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.
Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...
Gespeichert in:
| Hauptverfasser: | , , , |
|---|---|
| Format: | Artigo |
| Sprache: | Inglês |
| Veröffentlicht: |
1981
|
| Online Zugang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC326894/ https://ncbi.nlm.nih.gov/pubmed/7279661 |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|