Chargement en cours...

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...

Description complète

Enregistré dans:
Détails bibliographiques
Auteurs principaux: Delihas, N, Andersen, J, Sprouse, H M, Dudock, B
Format: Artigo
Langue:Inglês
Publié: 1981
Accès en ligne:https://ncbi.nlm.nih.gov/pmc/articles/PMC326894/
https://ncbi.nlm.nih.gov/pubmed/7279661
Tags: Ajouter un tag
Pas de tags, Soyez le premier à ajouter un tag!