The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Main Authors: Delihas, N, Andersen, J, Sprouse, H M, Dudock, B
Format: Artigo
Sprog:Inglês
Udgivet: 1981
Online adgang:https://ncbi.nlm.nih.gov/pmc/articles/PMC326894/
https://ncbi.nlm.nih.gov/pubmed/7279661
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!

Lignende værker