The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.
Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...
সংরক্ষণ করুন:
| প্রকাশিত: | Nucleic Acids Res |
|---|---|
| প্রধান লেখক: | , , , |
| বিন্যাস: | Artigo |
| ভাষা: | Inglês |
| প্রকাশিত: |
Oxford University Press
1981
|
| অনলাইন ব্যবহার করুন: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326894/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7279661/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.12.2801 |
| ট্যাগগুলো: |
কোনো ট্যাগ নেই, প্রথমজন হিসাবে ট্যাগ করুন!
|