The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted...

Descrición completa

Detalles Bibliográficos

Publicado en:	Nucleic Acids Res
Principais autores:	Delihas, N, Andersen, J, Sprouse, H M, Dudock, B
Formato:	Artigo
Idioma:	Inglês
Publicado:	Oxford University Press 1981
Acceso en liña:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326894/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7279661/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.12.2801
Tags:	Engadir etiqueta Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!