Llwytho...
The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
Wedi'i Gadw mewn:
| Prif Awduron: | , , , |
|---|---|
| Fformat: | Artigo |
| Iaith: | Inglês |
| Cyhoeddwyd: |
1982
|
| Mynediad Ar-lein: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320948/ https://ncbi.nlm.nih.gov/pubmed/7145715 |
| Tagiau: |
Ychwanegu Tag
Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!
|