The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
Αποθηκεύτηκε σε:
| Εκδόθηκε σε: | Nucleic Acids Res |
|---|---|
| Κύριοι συγγραφείς: | , , , |
| Μορφή: | Artigo |
| Γλώσσα: | Inglês |
| Έκδοση: |
Oxford University Press
1982
|
| Διαθέσιμο Online: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC320948/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7145715/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/10.19.6037 |
| Ετικέτες: |
Δεν υπάρχουν, Καταχωρήστε ετικέτα πρώτοι!
|