Caricamento...

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-...

Descrizione completa

Salvato in:
Dettagli Bibliografici
Autori principali: Takaiwa, F, Sugiura, M
Natura: Artigo
Lingua:Inglês
Pubblicazione: 1982
Accesso online:https://ncbi.nlm.nih.gov/pmc/articles/PMC320878/
https://ncbi.nlm.nih.gov/pubmed/6815619
Tags: Aggiungi Tag
Nessun Tag, puoi essere il primo ad aggiungerne! !