Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...

Disgrifiad llawn

Wedi'i Gadw mewn:
Manylion Llyfryddiaeth
Cyhoeddwyd yn:EMBO J
Prif Awduron: Thomsen, B, Mollerup, S, Bonven, B J, Frank, R, Blöcker, H, Nielsen, O F, Westergaard, O
Fformat: Artigo
Iaith:Inglês
Cyhoeddwyd: Nature Publishing Group 1987
Pynciau:
Research Article
Mynediad Ar-lein:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC553560/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/3038537/
https://ncbi.nlm.nih.govhttps://doi.org/10.1002/j.1460-2075.1987.tb02436.x
Tagiau: Ychwanegu Tag
Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!

Eitemau Tebyg