Cargando...
Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...
Gardado en:
| Main Authors: | , , , , , , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado: |
1987
|
| Assuntos: | |
| Acceso en liña: | https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/ https://ncbi.nlm.nih.gov/pubmed/3038537 |
| Tags: |
Engadir etiqueta
Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!
|