Llwytho...
Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...
Wedi'i Gadw mewn:
| Cyhoeddwyd yn: | EMBO J |
|---|---|
| Prif Awduron: | , , , , , , |
| Fformat: | Artigo |
| Iaith: | Inglês |
| Cyhoeddwyd: |
Nature Publishing Group
1987
|
| Pynciau: | |
| Mynediad Ar-lein: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC553560/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/3038537/ https://ncbi.nlm.nih.govhttps://doi.org/10.1002/j.1460-2075.1987.tb02436.x |
| Tagiau: |
Ychwanegu Tag
Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!
|