Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...

Deskribapen osoa

Gorde:
Xehetasun bibliografikoak
Egile Nagusiak: Thomsen, B, Mollerup, S, Bonven, B J, Frank, R, Blöcker, H, Nielsen, O F, Westergaard, O
Formatua: Artigo
Hizkuntza:Inglês
Argitaratua: 1987
Gaiak:
Research Article
Sarrera elektronikoa:https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/
https://ncbi.nlm.nih.gov/pubmed/3038537
Etiketak: Etiketa erantsi
Etiketarik gabe, Izan zaitez lehena erregistro honi etiketa jartzen!

Antzeko izenburuak