Lataa...
Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...
Tallennettuna:
| Julkaisussa: | EMBO J |
|---|---|
| Päätekijät: | , , , , , , |
| Aineistotyyppi: | Artigo |
| Kieli: | Inglês |
| Julkaistu: |
Nature Publishing Group
1987
|
| Aiheet: | |
| Linkit: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC553560/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/3038537/ https://ncbi.nlm.nih.govhttps://doi.org/10.1002/j.1460-2075.1987.tb02436.x |
| Tagit: |
Lisää tagi
Ei tageja, Lisää ensimmäinen tagi!
|