Загрузка...
Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...
Сохранить в:
| Главные авторы: | , , , , , , |
|---|---|
| Формат: | Artigo |
| Язык: | Inglês |
| Опубликовано: |
1987
|
| Предметы: | |
| Online-ссылка: | https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/ https://ncbi.nlm.nih.gov/pubmed/3038537 |
| Метки: |
Добавить метку
Нет меток, Требуется 1-ая метка записи!
|