Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...

Descripción completa

Guardado en:
Detalles Bibliográficos
Autores principales: Thomsen, B, Mollerup, S, Bonven, B J, Frank, R, Blöcker, H, Nielsen, O F, Westergaard, O
Formato: Artigo
Lenguaje:Inglês
Publicado: 1987
Materias:
Research Article
Acceso en línea:https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/
https://ncbi.nlm.nih.gov/pubmed/3038537
Etiquetas: Agregar Etiqueta
Sin Etiquetas, Sea el primero en etiquetar este registro!

Ejemplares similares