Wordt geladen...
Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...
Bewaard in:
| Gepubliceerd in: | EMBO J |
|---|---|
| Hoofdauteurs: | , , , , , , |
| Formaat: | Artigo |
| Taal: | Inglês |
| Gepubliceerd in: |
Nature Publishing Group
1987
|
| Onderwerpen: | |
| Online toegang: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC553560/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/3038537/ https://ncbi.nlm.nih.govhttps://doi.org/10.1002/j.1460-2075.1987.tb02436.x |
| Tags: |
Voeg label toe
Geen labels, Wees de eerste die dit record labelt!
|