Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...

Volledige beschrijving

Bewaard in:
Bibliografische gegevens
Gepubliceerd in:EMBO J
Hoofdauteurs: Thomsen, B, Mollerup, S, Bonven, B J, Frank, R, Blöcker, H, Nielsen, O F, Westergaard, O
Formaat: Artigo
Taal:Inglês
Gepubliceerd in: Nature Publishing Group 1987
Onderwerpen:
Research Article
Online toegang:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC553560/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/3038537/
https://ncbi.nlm.nih.govhttps://doi.org/10.1002/j.1460-2075.1987.tb02436.x
Tags: Voeg label toe
Geen labels, Wees de eerste die dit record labelt!

Gelijkaardige items