Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Main Authors: Thomsen, B, Mollerup, S, Bonven, B J, Frank, R, Blöcker, H, Nielsen, O F, Westergaard, O
Format: Artigo
Sprog:Inglês
Udgivet: 1987
Fag:
Research Article
Online adgang:https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/
https://ncbi.nlm.nih.gov/pubmed/3038537
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!

Lignende værker