Caricamento...

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...

Descrizione completa

Salvato in:
Dettagli Bibliografici
Autori principali: Thomsen, B, Mollerup, S, Bonven, B J, Frank, R, Blöcker, H, Nielsen, O F, Westergaard, O
Natura: Artigo
Lingua:Inglês
Pubblicazione: 1987
Soggetti:
Accesso online:https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/
https://ncbi.nlm.nih.gov/pubmed/3038537
Tags: Aggiungi Tag
Nessun Tag, puoi essere il primo ad aggiungerne! !