Caricamento...
Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...
Salvato in:
| Autori principali: | , , , , , , |
|---|---|
| Natura: | Artigo |
| Lingua: | Inglês |
| Pubblicazione: |
1987
|
| Soggetti: | |
| Accesso online: | https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/ https://ncbi.nlm.nih.gov/pubmed/3038537 |
| Tags: |
Aggiungi Tag
Nessun Tag, puoi essere il primo ad aggiungerne! !
|