Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...

Ful tanımlama

Kaydedildi:
Detaylı Bibliyografya
Asıl Yazarlar: Thomsen, B, Mollerup, S, Bonven, B J, Frank, R, Blöcker, H, Nielsen, O F, Westergaard, O
Materyal Türü: Artigo
Dil:Inglês
Baskı/Yayın Bilgisi: 1987
Konular:
Research Article
Online Erişim:https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/
https://ncbi.nlm.nih.gov/pubmed/3038537
Etiketler: Etiketle
Etiket eklenmemiş, İlk siz ekleyin!

Benzer Materyaller