Loading...
Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...
Na minha lista:
| Main Authors: | , , , , , , |
|---|---|
| Format: | Artigo |
| Sprog: | Inglês |
| Udgivet: |
1987
|
| Fag: | |
| Online adgang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/ https://ncbi.nlm.nih.gov/pubmed/3038537 |
| Tags: |
Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!
|