Carregant...
Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I w...
Guardat en:
| Autors principals: | , , , , , , |
|---|---|
| Format: | Artigo |
| Idioma: | Inglês |
| Publicat: |
1987
|
| Matèries: | |
| Accés en línia: | https://ncbi.nlm.nih.gov/pmc/articles/PMC553560/ https://ncbi.nlm.nih.gov/pubmed/3038537 |
| Etiquetes: |
Afegir etiqueta
Sense etiquetes, Sigues el primer a etiquetar aquest registre!
|