Loading...
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to thos...
Na minha lista:
| Main Authors: | , , , , |
|---|---|
| Format: | Artigo |
| Sprog: | Inglês |
| Udgivet: |
1981
|
| Fag: | |
| Online adgang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC327528/ https://ncbi.nlm.nih.gov/pubmed/7301591 |
| Tags: |
Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!
|