The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to thos...

Szczegółowa specyfikacja

Opis bibliograficzny

Wydane w:	Nucleic Acids Res
Główni autorzy:	Hori, H, Sawada, M, Osawa, S, Murao, K, Ishikura, H
Format:	Artigo
Język:	Inglês
Wydane:	Oxford University Press 1981
Hasła przedmiotowe:	Research Article
Dostęp online:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327528/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7301591/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.20.5407
Etykiety:	Dodaj etykietę Nie ma etykietki, Dołącz pierwszą etykiete!