The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to thos...

Fuld beskrivelse

Bibliografiske detaljer

Udgivet i:	Nucleic Acids Res
Principais autores:	Hori, H, Sawada, M, Osawa, S, Murao, K, Ishikura, H
Format:	Artigo
Sprog:	Inglês
Udgivet:	Oxford University Press 1981
Fag:	Research Article
Online adgang:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327528/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7301591/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.20.5407
Tags:	Tilføj Tag Ingen Tags, Vær først til at tagge denne postø!