The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to thos...

Popoln opis

Bibliografske podrobnosti

izdano v:	Nucleic Acids Res
Principais autores:	Hori, H, Sawada, M, Osawa, S, Murao, K, Ishikura, H
Format:	Artigo
Jezik:	Inglês
Izdano:	Oxford University Press 1981
Teme:	Research Article
Online dostop:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327528/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7301591/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.20.5407
Oznake:	Označite Brez oznak, prvi označite!