The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to thos...

Descripció completa

Dades bibliogràfiques

Publicat a:	Nucleic Acids Res
Autors principals:	Hori, H, Sawada, M, Osawa, S, Murao, K, Ishikura, H
Format:	Artigo
Idioma:	Inglês
Publicat:	Oxford University Press 1981
Matèries:	Research Article
Accés en línia:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327528/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7301591/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.20.5407
Etiquetes:	Afegir etiqueta Sense etiquetes, Sigues el primer a etiquetar aquest registre!