The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to thos...

ver descrição completa

Detalhes bibliográficos

Publicado no:	Nucleic Acids Res
Principais autores:	Hori, H, Sawada, M, Osawa, S, Murao, K, Ishikura, H
Formato:	Artigo
Idioma:	Inglês
Publicado em:	Oxford University Press 1981
Assuntos:	Research Article
Acesso em linha:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC327528/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7301591/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.20.5407
Tags:	Adicionar Tag Sem tags, seja o primeiro a adicionar uma tag!