The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to thos...

Descrición completa

Gardado en:
Detalles Bibliográficos
Main Authors: Hori, H, Sawada, M, Osawa, S, Murao, K, Ishikura, H
Formato: Artigo
Idioma:Inglês
Publicado: 1981
Assuntos:
Research Article
Acceso en liña:https://ncbi.nlm.nih.gov/pmc/articles/PMC327528/
https://ncbi.nlm.nih.gov/pubmed/7301591
Tags: Engadir etiqueta
Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!

Títulos similares