Wordt geladen...
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to thos...
Bewaard in:
| Hoofdauteurs: | , , , , |
|---|---|
| Formaat: | Artigo |
| Taal: | Inglês |
| Gepubliceerd in: |
1981
|
| Onderwerpen: | |
| Online toegang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC327528/ https://ncbi.nlm.nih.gov/pubmed/7301591 |
| Tags: |
Voeg label toe
Geen labels, Wees de eerste die dit record labelt!
|