A carregar...
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...
Na minha lista:
| Main Authors: | , , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1980
|
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324323/ https://ncbi.nlm.nih.gov/pubmed/7465421 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|