লোডিং...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

সম্পূর্ণ বিবরণ

সংরক্ষণ করুন:
গ্রন্থ-পঞ্জীর বিবরন
প্রধান লেখক: Hori, H, Osawa, S, Iwabuchi, M
বিন্যাস: Artigo
ভাষা:Inglês
প্রকাশিত: 1980
অনলাইন ব্যবহার করুন:https://ncbi.nlm.nih.gov/pmc/articles/PMC324323/
https://ncbi.nlm.nih.gov/pubmed/7465421
ট্যাগগুলো: ট্যাগ যুক্ত করুন
কোনো ট্যাগ নেই, প্রথমজন হিসাবে ট্যাগ করুন!