Φορτώνει......
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...
Αποθηκεύτηκε σε:
| Κύριοι συγγραφείς: | , , |
|---|---|
| Μορφή: | Artigo |
| Γλώσσα: | Inglês |
| Έκδοση: |
1980
|
| Διαθέσιμο Online: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324323/ https://ncbi.nlm.nih.gov/pubmed/7465421 |
| Ετικέτες: |
Προσθήκη ετικέτας
Δεν υπάρχουν, Καταχωρήστε ετικέτα πρώτοι!
|