טוען...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

תיאור מלא

שמור ב:
מידע ביבליוגרפי
Main Authors: Hori, H, Osawa, S, Iwabuchi, M
פורמט: Artigo
שפה:Inglês
יצא לאור: 1980
גישה מקוונת:https://ncbi.nlm.nih.gov/pmc/articles/PMC324323/
https://ncbi.nlm.nih.gov/pubmed/7465421
תגים: הוספת תג
אין תגיות, היה/י הראשונ/ה לתייג את הרשומה!