טוען...
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...
שמור ב:
| Main Authors: | , , |
|---|---|
| פורמט: | Artigo |
| שפה: | Inglês |
| יצא לאור: |
1980
|
| גישה מקוונת: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324323/ https://ncbi.nlm.nih.gov/pubmed/7465421 |
| תגים: |
הוספת תג
אין תגיות, היה/י הראשונ/ה לתייג את הרשומה!
|