The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...
Պահպանված է:
| Հրատարակված է: | Nucleic Acids Res |
|---|---|
| Հիմնական հեղինակներ: | , , |
| Ձևաչափ: | Artigo |
| Լեզու: | Inglês |
| Հրապարակվել է: |
Oxford University Press
1980
|
| Առցանց հասանելիություն: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324323/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7465421/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.23.5535 |
| Ցուցիչներ: |
Չկան պիտակներ, Եղեք առաջինը, ով նշում է այս գրառումը!
|