Loading...
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...
Na minha lista:
| Udgivet i: | Nucleic Acids Res |
|---|---|
| Main Authors: | , , |
| Format: | Artigo |
| Sprog: | Inglês |
| Udgivet: |
Oxford University Press
1980
|
| Online adgang: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324323/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7465421/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.23.5535 |
| Tags: |
Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!
|