Loading...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Udgivet i:Nucleic Acids Res
Main Authors: Hori, H, Osawa, S, Iwabuchi, M
Format: Artigo
Sprog:Inglês
Udgivet: Oxford University Press 1980
Online adgang:https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324323/
https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7465421/
https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.23.5535
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!