Á lódáil...
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...
Na minha lista:
| Main Authors: | , , |
|---|---|
| Formáid: | Artigo |
| Teanga: | Inglês |
| Foilsithe: |
1980
|
| Rochtain Ar Líne: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324323/ https://ncbi.nlm.nih.gov/pubmed/7465421 |
| Clibeanna: |
Cuir Clib Leis
Gan Chlibeanna, Bí ar an gcéad duine leis an taifead seo a chlibeáil!
|