The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

Full description

Saved in:
Bibliographic Details
Main Authors: Hori, H, Osawa, S, Iwabuchi, M
Format: Artigo
Language:Inglês
Published: 1980
Online Access:https://ncbi.nlm.nih.gov/pmc/articles/PMC324323/
https://ncbi.nlm.nih.gov/pubmed/7465421
Tags: Add Tag
No Tags, Be the first to tag this record!

Similar Items