The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

Disgrifiad llawn

Manylion Llyfryddiaeth

Cyhoeddwyd yn:	Nucleic Acids Res
Prif Awduron:	Hori, H, Osawa, S, Iwabuchi, M
Fformat:	Artigo
Iaith:	Inglês
Cyhoeddwyd:	Oxford University Press 1980
Mynediad Ar-lein:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324323/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7465421/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.23.5535
Tagiau:	Ychwanegu Tag Dim Tagiau, Byddwch y cyntaf i dagio'r cofnod hwn!