The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

Mô tả đầy đủ

Chi tiết về thư mục

Xuất bản năm:	Nucleic Acids Res
Những tác giả chính:	Hori, H, Osawa, S, Iwabuchi, M
Định dạng:	Artigo
Ngôn ngữ:	Inglês
Được phát hành:	Oxford University Press 1980
Truy cập trực tuyến:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324323/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7465421/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.23.5535
Các nhãn:	Thêm thẻ Không có thẻ, Là người đầu tiên thẻ bản ghi này!