The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

Ausführliche Beschreibung

Bibliografische Detailangaben

Veröffentlicht in:	Nucleic Acids Res
Hauptverfasser:	Hori, H, Osawa, S, Iwabuchi, M
Format:	Artigo
Sprache:	Inglês
Veröffentlicht:	Oxford University Press 1980
Online-Zugang:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324323/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7465421/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.23.5535
Tags:	Tag hinzufügen Keine Tags, Fügen Sie das erste Tag hinzu!