The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

Πλήρης περιγραφή

Λεπτομέρειες βιβλιογραφικής εγγραφής

Εκδόθηκε σε:	Nucleic Acids Res
Κύριοι συγγραφείς:	Hori, H, Osawa, S, Iwabuchi, M
Μορφή:	Artigo
Γλώσσα:	Inglês
Έκδοση:	Oxford University Press 1980
Διαθέσιμο Online:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324323/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7465421/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.23.5535
Ετικέτες:	Προσθήκη ετικέτας Δεν υπάρχουν, Καταχωρήστε ετικέτα πρώτοι!