The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence...

Celý popis

Uloženo v:
Podrobná bibliografie
Hlavní autoři: Hori, H, Osawa, S, Iwabuchi, M
Médium: Artigo
Jazyk:Inglês
Vydáno: 1980
On-line přístup:https://ncbi.nlm.nih.gov/pmc/articles/PMC324323/
https://ncbi.nlm.nih.gov/pubmed/7465421
Tagy: Přidat tag
Žádné tagy, Buďte první, kdo otaguje tento záznam!

Podobné jednotky