Á lódáil...
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...
Na minha lista:
| Main Authors: | , , , |
|---|---|
| Formáid: | Artigo |
| Teanga: | Inglês |
| Foilsithe: |
1980
|
| Rochtain Ar Líne: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324311/ https://ncbi.nlm.nih.gov/pubmed/6780979 |
| Clibeanna: |
Cuir Clib Leis
Gan Chlibeanna, Bí ar an gcéad duine leis an taifead seo a chlibeáil!
|