The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...

Description complète

Détails bibliographiques

Publié dans:	Nucleic Acids Res
Auteurs principaux:	Hori, H, Osawa, S, Murao, K, Ishikura, H
Format:	Artigo
Langue:	Inglês
Publié:	Oxford University Press 1980
Accès en ligne:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324311/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6780979/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.22.5423
Tags:	Ajouter un tag Pas de tags, Soyez le premier à ajouter un tag!