The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...

Deskribapen osoa

Xehetasun bibliografikoak

Argitaratua izan da:	Nucleic Acids Res
Egile Nagusiak:	Hori, H, Osawa, S, Murao, K, Ishikura, H
Formatua:	Artigo
Hizkuntza:	Inglês
Argitaratua:	Oxford University Press 1980
Sarrera elektronikoa:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324311/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6780979/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.22.5423
Etiketak:	Etiketa erantsi Etiketarik gabe, Izan zaitez lehena erregistro honi etiketa jartzen!