The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...
সংরক্ষণ করুন:
| প্রকাশিত: | Nucleic Acids Res |
|---|---|
| প্রধান লেখক: | , , , |
| বিন্যাস: | Artigo |
| ভাষা: | Inglês |
| প্রকাশিত: |
Oxford University Press
1980
|
| অনলাইন ব্যবহার করুন: | https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324311/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6780979/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.22.5423 |
| ট্যাগগুলো: |
কোনো ট্যাগ নেই, প্রথমজন হিসাবে ট্যাগ করুন!
|