A carregar...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...

ver descrição completa

Na minha lista:
Detalhes bibliográficos
Main Authors: Hori, H, Osawa, S, Murao, K, Ishikura, H
Formato: Artigo
Idioma:Inglês
Publicado em: 1980
Acesso em linha:https://ncbi.nlm.nih.gov/pmc/articles/PMC324311/
https://ncbi.nlm.nih.gov/pubmed/6780979
Tags: Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!