Wordt geladen...
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...
Bewaard in:
| Hoofdauteurs: | , , , |
|---|---|
| Formaat: | Artigo |
| Taal: | Inglês |
| Gepubliceerd in: |
1980
|
| Online toegang: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324311/ https://ncbi.nlm.nih.gov/pubmed/6780979 |
| Tags: |
Voeg label toe
Geen labels, Wees de eerste die dit record labelt!
|