The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...

ver descrição completa

Detalhes bibliográficos

Publicado no:	Nucleic Acids Res
Principais autores:	Hori, H, Osawa, S, Murao, K, Ishikura, H
Formato:	Artigo
Idioma:	Inglês
Publicado em:	Oxford University Press 1980
Acesso em linha:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC324311/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/6780979/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/8.22.5423
Tags:	Adicionar Tag Sem tags, seja o primeiro a adicionar uma tag!