A carregar...
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...
Na minha lista:
| Main Authors: | , , , |
|---|---|
| Formato: | Artigo |
| Idioma: | Inglês |
| Publicado em: |
1980
|
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC324311/ https://ncbi.nlm.nih.gov/pubmed/6780979 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|