Wordt geladen...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and the...

Volledige beschrijving

Bewaard in:
Bibliografische gegevens
Hoofdauteurs: Hori, H, Osawa, S, Murao, K, Ishikura, H
Formaat: Artigo
Taal:Inglês
Gepubliceerd in: 1980
Online toegang:https://ncbi.nlm.nih.gov/pmc/articles/PMC324311/
https://ncbi.nlm.nih.gov/pubmed/6780979
Tags: Voeg label toe
Geen labels, Wees de eerste die dit record labelt!