The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

Descrición completa

Gardado en:
Detalles Bibliográficos
Main Authors: Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Formato: Artigo
Idioma:Inglês
Publicado: 1981
Acceso en liña:https://ncbi.nlm.nih.gov/pmc/articles/PMC326725/
https://ncbi.nlm.nih.gov/pubmed/7232209
Tags: Engadir etiqueta
Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!

Títulos similares