The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

Descripció completa

Dades bibliogràfiques

Publicat a:	Nucleic Acids Res
Autors principals:	Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Format:	Artigo
Idioma:	Inglês
Publicat:	Oxford University Press 1981
Accés en línia:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326725/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7232209/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.4.965
Etiquetes:	Afegir etiqueta Sense etiquetes, Sigues el primer a etiquetar aquest registre!