Φορτώνει......
The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.
The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...
Αποθηκεύτηκε σε:
| Κύριοι συγγραφείς: | , , , , , , |
|---|---|
| Μορφή: | Artigo |
| Γλώσσα: | Inglês |
| Έκδοση: |
1981
|
| Διαθέσιμο Online: | https://ncbi.nlm.nih.gov/pmc/articles/PMC326725/ https://ncbi.nlm.nih.gov/pubmed/7232209 |
| Ετικέτες: |
Προσθήκη ετικέτας
Δεν υπάρχουν, Καταχωρήστε ετικέτα πρώτοι!
|