The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

ver descrição completa

Detalhes bibliográficos

Publicado no:	Nucleic Acids Res
Principais autores:	Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Formato:	Artigo
Idioma:	Inglês
Publicado em:	Oxford University Press 1981
Acesso em linha:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326725/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7232209/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.4.965
Tags:	Adicionar Tag Sem tags, seja o primeiro a adicionar uma tag!