The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

Volledige beschrijving

Bibliografische gegevens

Gepubliceerd in:	Nucleic Acids Res
Hoofdauteurs:	Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Formaat:	Artigo
Taal:	Inglês
Gepubliceerd in:	Oxford University Press 1981
Online toegang:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326725/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7232209/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.4.965
Tags:	Voeg label toe Geen labels, Wees de eerste die dit record labelt!