Loading...

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

Fuld beskrivelse

Na minha lista:
Bibliografiske detaljer
Main Authors: Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Format: Artigo
Sprog:Inglês
Udgivet: 1981
Online adgang:https://ncbi.nlm.nih.gov/pmc/articles/PMC326725/
https://ncbi.nlm.nih.gov/pubmed/7232209
Tags: Tilføj Tag
Ingen Tags, Vær først til at tagge denne postø!