The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology w...

Descrición completa

Detalles Bibliográficos

Publicado en:	Nucleic Acids Res
Principais autores:	Luehrsen, K R, Fox, G E, Kilpatrick, M W, Walker, R T, Domdey, H, Krupp, G, Gross, H J
Formato:	Artigo
Idioma:	Inglês
Publicado:	Oxford University Press 1981
Acceso en liña:	https://ncbi.nlm.nih.govhttps://pmc.ncbi.nlm.nih.gov/articles/PMC326725/ https://ncbi.nlm.nih.govhttps://pubmed.ncbi.nlm.nih.gov/7232209/ https://ncbi.nlm.nih.govhttps://doi.org/10.1093/nar/9.4.965
Tags:	Engadir etiqueta Sen Etiquetas, Sexa o primeiro en etiquetar este rexistro!